I use a few hundred at most and in those cases I just feed power at several points in the chain to reduce resistive losses in the wiring. But yeah I'm kinda interested what kind of huge installations would need that and how they work.
Location: Los Angeles, CA
Remote: Yes
Willing to relocate: No
Technologies: Node.js, Express, jQuery, PostgreSQL, NGINX/HAProxy, Docker/containers, Linux
Résumé/CV: resume.poyu.xyz
Email: hn@poyu.xyz
10+ years experience building web apps and services, computer is my hobby. Currently an engineering manager that still codes and work with PMs. My current job consists of talking with PMs, sorting out initial requirements and leading the team through thorough feature refinement process, also discussing with operations team to lay out plans for new features.
Looking for a change since my current company got acquired, and I've been in this role for quite a while now. Hoping to work on something meaningful, to myself or the community.
But that doesn’t make any sense. A link might be printed in a book. Nobody accessed it, yet they might at some point. Such a service is quite good for printing in books, instead of QR-codes.
It's fundamentally different than a computer and arguably more complete.
The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
"Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.
If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.
Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)
Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.
Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?
Someone should have said this to me:
> Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
>
> This is biology.
–Bert Hubert, “Our Amazing Immune System”
This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).
True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.